ID: 1016647574_1016647578 |
View in Genome Browser |
Spacer: -3 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1016647574 | 1016647578 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:146427504-146427526 | 6:146427524-146427546 |
| Sequence | CCCAATTTGTTCAAATGTCTGCT | GCTACTGAACCTGGCCATGGAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 2, 3: 44, 4: 336} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||