ID: 1016672285_1016672289

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1016672285 1016672289
Species Human (GRCh38) Human (GRCh38)
Location 6:146722818-146722840 6:146722845-146722867
Sequence CCACCTTCCTTCTGTTCTAATGG ACAATCTCTGCTCCTCTACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 314} {0: 1, 1: 0, 2: 1, 3: 12, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!