ID: 1016746823_1016746824

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1016746823 1016746824
Species Human (GRCh38) Human (GRCh38)
Location 6:147589648-147589670 6:147589661-147589683
Sequence CCAACTGCATGGGTATGACTCCA TATGACTCCACCATAACTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 104} {0: 1, 1: 0, 2: 1, 3: 4, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!