ID: 1016752370_1016752374

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1016752370 1016752374
Species Human (GRCh38) Human (GRCh38)
Location 6:147645155-147645177 6:147645197-147645219
Sequence CCCACACGACAGGACATCTTACT AGCAGTTGATGGCATGTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49} {0: 1, 1: 0, 2: 0, 3: 10, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!