ID: 1016776385_1016776390 |
View in Genome Browser |
Spacer: -4 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1016776385 | 1016776390 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:147909195-147909217 | 6:147909214-147909236 |
| Sequence | CCTGCAACAACAACAAAAAAACT | AACTAGGCCTTGATGTGGAGGGG |
| Strand | - | + |
| Off-target summary | {0: 2, 1: 11, 2: 91, 3: 444, 4: 1791} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||