ID: 1016785868_1016785878

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1016785868 1016785878
Species Human (GRCh38) Human (GRCh38)
Location 6:148010506-148010528 6:148010543-148010565
Sequence CCCAGCTCCAGCTGTGGCTAAAA ACTTGGCCTATTGCTTCAGAGGG
Strand - +
Off-target summary {0: 4, 1: 10, 2: 33, 3: 41, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!