ID: 1016820677_1016820682

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1016820677 1016820682
Species Human (GRCh38) Human (GRCh38)
Location 6:148343164-148343186 6:148343193-148343215
Sequence CCGGGTGCTGGCACATCCGAGGC CCGACTCTGGACCGACGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 156} {0: 1, 1: 0, 2: 0, 3: 0, 4: 22}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!