|
Left Crispr |
Right Crispr |
| Crispr ID |
1016824780 |
1016824784 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:148378210-148378232
|
6:148378224-148378246
|
| Sequence |
CCTGGCTAATTTTTTTGTATTTT |
TTGTATTTTCAGTAAAGGCGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 15212, 1: 17469, 2: 21303, 3: 48467, 4: 228516} |
{0: 3, 1: 229, 2: 8907, 3: 122382, 4: 228424} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|