ID: 1016827032_1016827042

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1016827032 1016827042
Species Human (GRCh38) Human (GRCh38)
Location 6:148397973-148397995 6:148398016-148398038
Sequence CCTTAGAGGAAGTGGTAACCCAG AGGGAAGACTGACCTGGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 137} {0: 1, 1: 0, 2: 2, 3: 11, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!