ID: 1016832252_1016832261

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1016832252 1016832261
Species Human (GRCh38) Human (GRCh38)
Location 6:148445651-148445673 6:148445695-148445717
Sequence CCCGTCATAGCCTCAAAGTGGCT GAAAAAGCAGGGCGAAGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 211} {0: 1, 1: 1, 2: 5, 3: 57, 4: 689}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!