|
Left Crispr |
Right Crispr |
| Crispr ID |
1016919572 |
1016919577 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:149278682-149278704
|
6:149278726-149278748
|
| Sequence |
CCTCCAGCTTATAAAACTCTCTT |
AAGGAGAAGTAGAGGAAGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 1, 3: 21, 4: 228} |
{0: 1, 1: 2, 2: 33, 3: 468, 4: 3278} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|