ID: 1016935645_1016935647

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1016935645 1016935647
Species Human (GRCh38) Human (GRCh38)
Location 6:149447461-149447483 6:149447487-149447509
Sequence CCAGGCTGGTCTCGAACTCCTGA CATGAAGCCCACCAAAGTGCTGG
Strand - +
Off-target summary {0: 51840, 1: 157012, 2: 220107, 3: 177064, 4: 94849} {0: 1, 1: 0, 2: 0, 3: 19, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!