ID: 1016950745_1016950749

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1016950745 1016950749
Species Human (GRCh38) Human (GRCh38)
Location 6:149577255-149577277 6:149577298-149577320
Sequence CCTTAGTCTTTGGGCTTACGGAC GTTCCACGAAGGAGACCCACGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!