ID: 1016952568_1016952578

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1016952568 1016952578
Species Human (GRCh38) Human (GRCh38)
Location 6:149594440-149594462 6:149594490-149594512
Sequence CCCGTAGAGGGCTGCGTCACTTC ACCAAGACCACAGGCTGCCGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 6, 4: 46} {0: 1, 1: 0, 2: 3, 3: 33, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!