ID: 1016952577_1016952581

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1016952577 1016952581
Species Human (GRCh38) Human (GRCh38)
Location 6:149594483-149594505 6:149594501-149594523
Sequence CCAGCACACCAAGACCACAGGCT AGGCTGCCGTGGCCGCATCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 24, 4: 196} {0: 1, 1: 0, 2: 2, 3: 4, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!