ID: 1016965221_1016965223

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1016965221 1016965223
Species Human (GRCh38) Human (GRCh38)
Location 6:149712495-149712517 6:149712521-149712543
Sequence CCATATTTTATCTTCTATTCTCT TTCTTTTTGAATAGAGATGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 24, 3: 147, 4: 962}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!