ID: 1016972705_1016972709

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1016972705 1016972709
Species Human (GRCh38) Human (GRCh38)
Location 6:149779339-149779361 6:149779361-149779383
Sequence CCTGCCACAAACTGCTTAAAAGG GTGATTGATCCCTTTGTTCAGGG
Strand - +
Off-target summary {0: 3, 1: 5, 2: 13, 3: 23, 4: 252} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!