ID: 1016987203_1016987210

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1016987203 1016987210
Species Human (GRCh38) Human (GRCh38)
Location 6:149904558-149904580 6:149904593-149904615
Sequence CCCCACATGGACACCTTCCTGCA CCCCATCTGAAAGAGCTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 35, 4: 241} {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!