ID: 1016993429_1016993432

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1016993429 1016993432
Species Human (GRCh38) Human (GRCh38)
Location 6:149944877-149944899 6:149944894-149944916
Sequence CCATCCTCACTCTGTTCAACCAG AACCAGCACCAGCATCCACAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 18, 4: 261} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!