ID: 1017021527_1017021538

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1017021527 1017021538
Species Human (GRCh38) Human (GRCh38)
Location 6:150143580-150143602 6:150143612-150143634
Sequence CCGGGGCGCGCATGTCCCTGACT CAAGTGCCAGGAGCGAGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65} {0: 1, 1: 0, 2: 2, 3: 19, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!