ID: 1017047716_1017047724

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1017047716 1017047724
Species Human (GRCh38) Human (GRCh38)
Location 6:150363278-150363300 6:150363292-150363314
Sequence CCCTCCTCCCCTTCCCCTAGTCT CCCTAGTCTCCAAAAATGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 142, 4: 1225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!