ID: 1017051772_1017051779

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1017051772 1017051779
Species Human (GRCh38) Human (GRCh38)
Location 6:150400061-150400083 6:150400085-150400107
Sequence CCCTGCTTGGGATTCAGGTGAAC AATGTAACGTGGGTGGGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 117} {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!