ID: 1017118308_1017118314

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1017118308 1017118314
Species Human (GRCh38) Human (GRCh38)
Location 6:150999936-150999958 6:150999976-150999998
Sequence CCCAGTAACTTCCTCATGTTCTG TCCCCTAATGTGTATGAACTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!