ID: 1017121452_1017121462

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1017121452 1017121462
Species Human (GRCh38) Human (GRCh38)
Location 6:151028079-151028101 6:151028113-151028135
Sequence CCTGCTGGGAAGCACACAGCCCT GGGAAGCAGGGCCGCCCAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 19, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!