ID: 1017126348_1017126353

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1017126348 1017126353
Species Human (GRCh38) Human (GRCh38)
Location 6:151067889-151067911 6:151067933-151067955
Sequence CCAGCCAAATGAACTCTGATGTG TTCTGGTGCATGTAAACAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 130} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!