ID: 1017159479_1017159484

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1017159479 1017159484
Species Human (GRCh38) Human (GRCh38)
Location 6:151351435-151351457 6:151351449-151351471
Sequence CCACAGAGGAGGCCACTCCGGTG ACTCCGGTGCAGGAGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 141} {0: 1, 1: 0, 2: 1, 3: 16, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!