ID: 1017174971_1017174988

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1017174971 1017174988
Species Human (GRCh38) Human (GRCh38)
Location 6:151494166-151494188 6:151494205-151494227
Sequence CCGCTTCGCCAGCGCCCGAGGTA CCGCGCGCGGGGGTGGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28} {0: 1, 1: 0, 2: 0, 3: 18, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!