ID: 1017174974_1017174988

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1017174974 1017174988
Species Human (GRCh38) Human (GRCh38)
Location 6:151494180-151494202 6:151494205-151494227
Sequence CCCGAGGTACGGTCCCAGCCGCC CCGCGCGCGGGGGTGGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 73} {0: 1, 1: 0, 2: 0, 3: 18, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!