ID: 1017179484_1017179486

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1017179484 1017179486
Species Human (GRCh38) Human (GRCh38)
Location 6:151536990-151537012 6:151537015-151537037
Sequence CCTTGAGAGATCTGGGGGCGCCT AGATGTTAAGTAAAGCTCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105} {0: 1, 1: 0, 2: 0, 3: 19, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!