ID: 1017207546_1017207549

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1017207546 1017207549
Species Human (GRCh38) Human (GRCh38)
Location 6:151819772-151819794 6:151819790-151819812
Sequence CCCAGTTCCATCTGTGGAAAAAT AAAATTGTCTTCCATGAAACCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 70, 4: 449} {0: 366, 1: 675, 2: 884, 3: 752, 4: 745}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!