ID: 1017207546_1017207556 |
View in Genome Browser |
Spacer: 24 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1017207546 | 1017207556 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:151819772-151819794 | 6:151819819-151819841 |
| Sequence | CCCAGTTCCATCTGTGGAAAAAT | AACTGGTGCCAAAAATGTTGGGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 1, 2: 11, 3: 70, 4: 449} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||