ID: 1017217700_1017217703

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1017217700 1017217703
Species Human (GRCh38) Human (GRCh38)
Location 6:151929426-151929448 6:151929458-151929480
Sequence CCTTTACTTTTAACATATCAGAG TTAAAGTGGGCATTATTACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 278} {0: 1, 1: 0, 2: 1, 3: 21, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!