ID: 1017227806_1017227809

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1017227806 1017227809
Species Human (GRCh38) Human (GRCh38)
Location 6:152041093-152041115 6:152041120-152041142
Sequence CCAAGAGTTGTCTCTCACAAGGA AGTTATCTGCAGGAGATGCAGGG
Strand - +
Off-target summary {0: 1, 1: 17, 2: 205, 3: 208, 4: 288} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!