ID: 1017238586_1017238588

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1017238586 1017238588
Species Human (GRCh38) Human (GRCh38)
Location 6:152142655-152142677 6:152142674-152142696
Sequence CCCAGTGATGTCAGTATGATTAC TTACCATAAAACTATATCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112} {0: 1, 1: 0, 2: 0, 3: 27, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!