ID: 1017239150_1017239154

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1017239150 1017239154
Species Human (GRCh38) Human (GRCh38)
Location 6:152147761-152147783 6:152147774-152147796
Sequence CCCACACTAGAGTGGAAGCTCTG GGAAGCTCTGGGAGAAGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 264} {0: 1, 1: 0, 2: 3, 3: 59, 4: 595}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!