ID: 1017247211_1017247214

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1017247211 1017247214
Species Human (GRCh38) Human (GRCh38)
Location 6:152239571-152239593 6:152239592-152239614
Sequence CCCGTTTCAGTACAGCAGAAGCC CCTGAGCCATCAGCTCTGTATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 4, 4: 114} {0: 1, 1: 0, 2: 1, 3: 14, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!