|
Left Crispr |
Right Crispr |
Crispr ID |
1017247211 |
1017247216 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:152239571-152239593
|
6:152239598-152239620
|
Sequence |
CCCGTTTCAGTACAGCAGAAGCC |
CCATCAGCTCTGTATGGAACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 1, 2: 2, 3: 4, 4: 114} |
{0: 1, 1: 1, 2: 0, 3: 5, 4: 100} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|