ID: 1017282127_1017282139

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1017282127 1017282139
Species Human (GRCh38) Human (GRCh38)
Location 6:152636842-152636864 6:152636886-152636908
Sequence CCGGCGGCCGCGGCCCGGCGCCC CCCACACTCACTCCCGCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 104, 4: 716} {0: 1, 1: 0, 2: 3, 3: 17, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!