ID: 1017294364_1017294371

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1017294364 1017294371
Species Human (GRCh38) Human (GRCh38)
Location 6:152776872-152776894 6:152776916-152776938
Sequence CCCACTGGGGTGCTGGTGGGCAG TATGACATTTATGAAGAATTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 35, 4: 392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!