ID: 1017307820_1017307822

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1017307820 1017307822
Species Human (GRCh38) Human (GRCh38)
Location 6:152939667-152939689 6:152939710-152939732
Sequence CCACAATGCTCGGTACAAAGATA ATAAATTAGCAACTGTTGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!