ID: 1017312379_1017312382

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1017312379 1017312382
Species Human (GRCh38) Human (GRCh38)
Location 6:152988818-152988840 6:152988863-152988885
Sequence CCAGCTTTTGGACTTGTTAGACT TCCTTTTAAGGAAGTTTGTCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 8, 4: 141} {0: 2, 1: 0, 2: 2, 3: 25, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!