ID: 1017313531_1017313540

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1017313531 1017313540
Species Human (GRCh38) Human (GRCh38)
Location 6:153002490-153002512 6:153002530-153002552
Sequence CCAGCAACTCGGGCCTCCTGACC CCCCGCCTGGCGCTCGAGGAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 12, 4: 177} {0: 2, 1: 0, 2: 0, 3: 9, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!