ID: 1017404540_1017404544

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1017404540 1017404544
Species Human (GRCh38) Human (GRCh38)
Location 6:154104141-154104163 6:154104187-154104209
Sequence CCTAGCTATTAGGGGCTCTTGTG CAGAAAGCATCAGTATGGCGAGG
Strand - +
Off-target summary No data {0: 3, 1: 24, 2: 37, 3: 59, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!