ID: 1017438122_1017438123

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1017438122 1017438123
Species Human (GRCh38) Human (GRCh38)
Location 6:154436919-154436941 6:154436943-154436965
Sequence CCTTGCAGGAGAAAAGAAGCAGC ATATGTATCCTTCAAATTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 399} {0: 1, 1: 0, 2: 3, 3: 13, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!