ID: 1017442212_1017442216

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1017442212 1017442216
Species Human (GRCh38) Human (GRCh38)
Location 6:154474869-154474891 6:154474897-154474919
Sequence CCTCCTGTGCCTGCTGACTTGAC CTGTGAGTGAGTCAGAAAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 25, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!