ID: 1017499795_1017499802

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1017499795 1017499802
Species Human (GRCh38) Human (GRCh38)
Location 6:155013172-155013194 6:155013214-155013236
Sequence CCATGGCTCCTGTAGTACAGCTG GGCTTAGTCTGTGCTCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 149} {0: 1, 1: 0, 2: 0, 3: 18, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!