ID: 1017520635_1017520641

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1017520635 1017520641
Species Human (GRCh38) Human (GRCh38)
Location 6:155198830-155198852 6:155198850-155198872
Sequence CCGAGGTCTCCATCAGTGGCACA ACATGTGTGGAGGGCACCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 282} {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!