ID: 1017524729_1017524738

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1017524729 1017524738
Species Human (GRCh38) Human (GRCh38)
Location 6:155232564-155232586 6:155232611-155232633
Sequence CCCTAGTTCTTCTGACTGATGTC ATGAGACTTGGATTCAGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 162} {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!