ID: 1017524735_1017524741

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1017524735 1017524741
Species Human (GRCh38) Human (GRCh38)
Location 6:155232586-155232608 6:155232633-155232655
Sequence CCTGGTTTGGGGAAACTCTGAGG GCTGATGGCTCAGCACAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 158} {0: 1, 1: 0, 2: 1, 3: 28, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!