ID: 1017526419_1017526428

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1017526419 1017526428
Species Human (GRCh38) Human (GRCh38)
Location 6:155245115-155245137 6:155245151-155245173
Sequence CCTTCTTCCCCGTGGTCATGTGG AGAATAGGTTTCTAATTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143} {0: 1, 1: 0, 2: 1, 3: 9, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!